BAT LAB – Days 7 and 8 – Phylogenetics

FUN FACT – The smallest bat is the Kitti’s Hog-Nosed bat which is also called the Bumblebee bat.

Over the past 2 days, Graham (with endless patience, thanks Graham)  has introduced us to the exciting world of Phylogenetics.  This is the area of Science where molecular sequencing data matrices and morphological data matrices are used to study the evolutionary relatedness between different groups of organisms. The goal  was to build a Phylogenetic Tree!!

Challenge accepted !!

Thankfully these are a variety of computer programmes that can carry out the steps required to achieve the end result amazingly quickly.  After BLASTING  on Day 6, the next task was Sequence Alignment where sequences of DNA are arranged in a way that allows for similar regions to be identified. These similar regions may be due to the evolutionary relatedness between the sequences. We chose to look at cytochrome b in five different species of bat. To carry out the alignment, we used a programme called Clustal X2.

Results from Alignment using Clustal X2

Results from Alignment using Clustal X2

Once this alignment was complete, it was time to use another programme called Mega to build our Phylogenetic Tree. Phylogenetic TreeThe tree shows the inferred evolutionary relationships between species. Challenge completed.

In reality however, it is more complex and much thought is required when selecting the sequences that should be included and much knowledge is required to meaningfully interpret the results once the tree has been drawn.

In the afternoon, we had a chance to sit with Prof. Teeling to talk about bats as a novel model for sensory driven speciation.

Olivia and I also had a good chat about our TY project plan.

Yet another great day in the BAT LAB. Thanks everyone.

BAT LAB Day 6 – Introduction to Bioinformatics!

Fun Fact: Bats can keep warm by wrapping their wings around them. This traps a layer of air around their bodies providing insulation.

I’ve said it already but I loved being in the lab last week. When we finished on Friday we had purified DNA, run PCR and visualised our samples post electrophoresis.

Loving the Lab Work :-)

Loving the Lab Work 🙂

So what comes next? Well, if your samples are of a good quality and the concentration of DNA in the samples is sufficient, the samples can undergo DNA sequencing, a technique by which the exact order of nucleotides within a DNA molecule can be determined. The process has come a long way since the initial manual  2-D chromatography methods were developed and today, automated procedures are used which have the advantage of speeding up turnaround times.

The sequencing result may look something like this: GAATAAATGTTGATACAGAATTGGGTCTCCTCCTCCTGCTGGGTCAAAGAATGAGGTATTTAAATTTCGA
TCAGTTAATAATATAGTAATTGCCCCGGCTAAAACTGGTAAAGATAAAAGTAATAATAAAGCTGTAATTA
CAACTGATCATACAAATAAAGGTATTCGATCTAAAGTAATTCCTGATGATCGTATATTAATTACAGTTGT
AATAAAATTTACAGCTCCTAAAATTGAAGAAATTCCGGCTAAATGTAAAGAGAAAATTGCTAAGTCAACA
GAAGCTCCACCATGTGCAATTCCTGATGATAGGGGAGGATAAACAGTTCACCCTGTTCCGGCCCCATTTT
CCACTATACTACTGACTAGAAGAAGGGATAGAGCTGGGGGAAGAAGTCAAAAACTTATATTATTTATTCG
AGGGAAGGCCATATCTGGGGCTCCCAATATTAAAGGAACTAATCAATTTCCAAATCCTCCAATTATAATA
GGTATAACTATAAAAAAAATTATAATAAAAGCATGAGCTGTAACATCT

……… to which I may respond AGHHHHHHHHHHHHHH, feeling like Neo before he learned how to read the Matrix!!

Thankfully, we are introduced to Graham who is going to introduce us to the world of Bioinformatics where software tools are used to analyse biological data.

Graham introduces us to software known as BLAST (Basic Local Alignment Search Tool). By using this software, the unknown or query sequence can be compared and contrasted against a database of known sequences. Amazingly, it does this in a matter of seconds.

photo 1

Results from BLAST search

Results from BLAST search

Results from BLAST search

The above results are from the analysis of bat faeces. By examining these results, it can be deduced that this particular bat ate mainly insects.

So why are we doing this?

We are looking for homologs. By studying homologs, it is possible to follow the evolutionary history of genes and to study other areas such as population changes.

The next step after BLAST is alignment. this brings us into the exciting world of Phylogenetics – more on that tomorrow.

Bat 3 BAT 2 BAT 1

 

 

 

 

 

 

Bat Lab Day 5

Fun Fact – Bats always exit stage cave left!  (The jury is still out on this one but more about echolocation in the coming weeks.

Day 5 in the Bat Lab and suffice to say, the week has flown. I am absolutely loving being back in the lab after being away from bench work for a few years.

Our task for this morning was to carry out electrophoresis on our samples from yesterday. Our results were not great this time and this turned out to be a fantastic learning opportunity. We discovered that our gel may not have been set completely before loading our samples, that our buffer needed changing and that human error  is always possible. Thankfully we had enough sample to repeat our experiment and paying attention to the potential errors outlined above, we had great success on the second run.

 

gel results 2 gel results

So what does all this barcoding tell us?

These  techniques can be used to identify and distinguish between different species. Choosing the right primer to amplify the correct section of DNA is paramount. If the primers are constructed around species – specific single nucleotide polymorphisms in the mitochondrial gene then species-specific bands are visible on the gel post electrophoresis thus allowing species identification and differentiation to be studied.

BAT 1 BAT 2 Bat 3Spot the difference?

At the close of week 1, I would like to express my sincere thanks to Dr. Lao for her endless patience and fantastic teaching this week. Looking forward to next week already 🙂

 

BAT LAB – Day 4

  FUN FACT – Bats can navigate in complete darkness using Echolocation. Day 4 in the Bat Lab and our challenge for the morning was to  carry out electrophoresis on our PCR samples that we prepared yesterday. Olivia and I prepared the gel, carefully loaded our precious samples and kept our fingers crossed that all would work!!

Prepared , ready to go.

Prepared gel , ready to go.

Using orange stain when preparing samples

Using 2ul of orange stain when preparing samples

Loading 8ul of sample.

Loading 8ul of sample.

Preparing samples for loading onto gel

Preparing samples for loading onto gel

photo 7 photo 6 photo 5 Loading samples onto gel. Care needs to be taken at this point to avoid puncturing the gel with the pipette tip. We used an orange stain for our samples. The well containing the blue stained sample is our control ladder to which we can compare our samples.

photo 8 photo 9Gel Electrophoresis  

Post Electrophoresis

Post Electrophoresis

During electrophoresis, the negatively charged DNA migrates towards the positive end of the gel with the smaller fragments moving faster and further than the larger ones.  The above picture shows what our gel looked like post electrophoresis. Because we had used a stain, we were able to visualise the bands in our DNA samples using a UV light. The resulting DNA barcode can bee seen below. photo 31 photo 30 We were delighted ( and very relieved) to know that our efforts were successful. We spent the afternoon preparing more samples for PCR and we  will run these samples in the morning.        

Bat Lab – Day 3 – Did our PCR work?

Fun Fact – While other mammals glide, bats actually fly. In fact, these clever mammals are the only ones capable of true and continued flight.

BAT 1

With the feelings in our stomachs akin to those of a student anxiously awaiting exam results, Olivia and I entered the Bat Lab this morning, apprehensively,  with one question on our minds – Did our PCR work?

In order to find out, we needed to carry out Gel Electrophoresis which is a technique used to separate fragments of DNA based on their size. We needed to prepare a gel that contained wells into which we could load our samples. We then carefully had to prepare our samples ( tiny and very precious) by mixing them with a stain.  Once that was done, we were ready to load our gel into a tank containing a buffer and to load our samples into the wells on the gel.

in Electrophoresis, an electric current is then run across the gel and as DNA is negatively charged, it will migrate towards the positive end of the gel. Smaller fragments will travel faster through the gel than larger ones.

So, without further ado and an abundance of enthusiasm, we launched into our tasks for the morning

Preparing the gel.

Preparing the gel.

Finished product

Finished product

 

 

Gel 7 Gel 5Carefully preparing samples. Very aware of how small and precious our samples are so concentrating hard.

E1 Electrophoresis 1Gel Electrophoresis – separating fragments of DNA based on size.

gel into machineBecause the DNA samples were mixed with a stain, they can now be viewed under a UV light.

SUCCESS!!! Our PCR worked

SUCCESS!!! Our PCR worked

We were thrilled to know that our PCR worked and so were ready for our next challenge. We spent the afternoon preparing more samples for PCR. Let’s see how that goes!!! We’ll find out tomorrow. 🙂

 

Bat Lab – Day 2

 

Fun Fact – The French for bat is chauve-souris – ‘bald mouse’ !!

Day 2 in the Bat Lab and with our DNA extraction complete, we are ready to see if our samples contain enough DNA to progress to the next stage. To analyse the DNA, we use a NanoDrop which is a spectrophotometer but for microvolumes. We are using 1ul of sample which seems petrifyingly tiny but is packed full of information. Loading the samples onto the NanoDrop requires a combination of a steady hand and a deft touch but somehow we manage and are samples are good enough to progress to the next stage – PCR.

Loading sample onto nanoDrop

Loading a sample onto the NanoDrop

nanodrop and computer Nanodrop 1

Steady hand and lots of concentration required.

Steady hand and lots of concentration required.

This tiny sample of 1 ul is packed with information.

This tiny sample of    1 ul is packed with information.

Success!! This graph shows that there is enough DNA to progress to the next stage.

Success!! This graph shows that there is enough DNA to progress to the next stage

Eager to learn more, Olivia and I spend the afternoon preparing our samples for PCR which stands for Polymerase Chain Reaction. PCR is a method for amplifying a specific region of DNA. The link below is for a You Tube clip which explains how PCR works. http://www.youtube.com/watch?v=eEcy9k_KsDI

We need to make up a reaction mixture in which to place our DNA samples.  The mixture itself is made up of: Autoclaved distilled water, PCR buffer, dNTP mixture, MgCl2, Primer mix and Taq DNA Polymerase. So under the watchful eye of our fantastic teacher Dr. Lao and working within a Laminar Flow cabinet to avoid potential contamination we undertake to complete the task in hand.

day 2 buffer 4

Making buffer in the Laminar Flow cabinet.

Making buffer in the Laminar Flow cabinet.

After adding our DNA samples into the buffer (the volumes that we are working with have progressed from petrifyingly tiny to petrifyingly miniscule!!) we are ready to load our samples onto the PCR machine.

DNA centrifuge

Tiny centrifuge for spinning our precious samples.

PCR Machine

PCR Machine

With fingers and toes crossed that our experiment will work, we head home after another fantastic day. Can’t believe that it is only Day 2 and we have already learned so much. Thanks Dr. Lao

 

 

 

 

 

Day 1 – Bat Lab – Our mission, should we choose to accept it!!

Day 1 and I nerdishly  arrive an hour early, partly because I am so excited to be starting the project (sincere thanks to Prof. Emma Teeling and Dr. Joanna Kacprzk for this opportunity) and partly because, if I am being perfectly honest ,due to the fact that U.C.D. is a sprawling mass of buildings, I know I’ll require time to find the right lab. Upon arrival at the Biology and Environmental Science Lab, I meet up with some of the fantastic  team from Prof Emma Teeling’s Bat Lab.  The lab is buzzing as some of the team are about to embark on a research trip to France.  I am then delighted to finally put a face to the name when I meet Olivia, my fellow teacher and co-conspirator for the next 4 weeks. Our mission ( we have chosen to accept it) is to spend one month learning all about bats and developing a Transition Year Biology programme. After a tour of the lab Olivia and I have some time to chat about our ideas for the project. We quickly discover that we are on the same wavelength and are aiming to design a 6 week TY module. To help with our project, I am reunited with a tome from my undergrad years (Campbell – Biology), albeit a far more updated version, which will provide some ‘light’ reading over the next few weeks methinks. So, with massive enthusiasm, we are ready to get started and spend the afternoon extracting DNA from Bat blood with the very patient and fantastic Dr. Nga Lao.

Concentrating hard

Concentrating hard

 

Old Lab Skills being refreshed

Old Lab Skills being refreshed

It’s fantastic to be back in the lab. The Phenol Chloroform DNA extraction that we are working on results in a very pure product and I am very aware that we are working in ul and with very  precious samples, therefore, frowning with concentration, I endeavour to recall my old lab skills of yore.  Great first day. Can’t wait for tomorrow.