BAT LAB Day 6 – Introduction to Bioinformatics!

Fun Fact: Bats can keep warm by wrapping their wings around them. This traps a layer of air around their bodies providing insulation.

I’ve said it already but I loved being in the lab last week. When we finished on Friday we had purified DNA, run PCR and visualised our samples post electrophoresis.

Loving the Lab Work :-)

Loving the Lab Work 🙂

So what comes next? Well, if your samples are of a good quality and the concentration of DNA in the samples is sufficient, the samples can undergo DNA sequencing, a technique by which the exact order of nucleotides within a DNA molecule can be determined. The process has come a long way since the initial manual  2-D chromatography methods were developed and today, automated procedures are used which have the advantage of speeding up turnaround times.

The sequencing result may look something like this: GAATAAATGTTGATACAGAATTGGGTCTCCTCCTCCTGCTGGGTCAAAGAATGAGGTATTTAAATTTCGA
TCAGTTAATAATATAGTAATTGCCCCGGCTAAAACTGGTAAAGATAAAAGTAATAATAAAGCTGTAATTA
CAACTGATCATACAAATAAAGGTATTCGATCTAAAGTAATTCCTGATGATCGTATATTAATTACAGTTGT
AATAAAATTTACAGCTCCTAAAATTGAAGAAATTCCGGCTAAATGTAAAGAGAAAATTGCTAAGTCAACA
GAAGCTCCACCATGTGCAATTCCTGATGATAGGGGAGGATAAACAGTTCACCCTGTTCCGGCCCCATTTT
CCACTATACTACTGACTAGAAGAAGGGATAGAGCTGGGGGAAGAAGTCAAAAACTTATATTATTTATTCG
AGGGAAGGCCATATCTGGGGCTCCCAATATTAAAGGAACTAATCAATTTCCAAATCCTCCAATTATAATA
GGTATAACTATAAAAAAAATTATAATAAAAGCATGAGCTGTAACATCT

……… to which I may respond AGHHHHHHHHHHHHHH, feeling like Neo before he learned how to read the Matrix!!

Thankfully, we are introduced to Graham who is going to introduce us to the world of Bioinformatics where software tools are used to analyse biological data.

Graham introduces us to software known as BLAST (Basic Local Alignment Search Tool). By using this software, the unknown or query sequence can be compared and contrasted against a database of known sequences. Amazingly, it does this in a matter of seconds.

photo 1

Results from BLAST search

Results from BLAST search

Results from BLAST search

The above results are from the analysis of bat faeces. By examining these results, it can be deduced that this particular bat ate mainly insects.

So why are we doing this?

We are looking for homologs. By studying homologs, it is possible to follow the evolutionary history of genes and to study other areas such as population changes.

The next step after BLAST is alignment. this brings us into the exciting world of Phylogenetics – more on that tomorrow.

Bat 3 BAT 2 BAT 1

 

 

 

 

 

 

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s