We have published our TY students syllabus!

Our Transition Year Syllabus has been published!

‘Boost Biology with Bats’

Transition Year Syllabus: Explore concepts of Genetics, Evolutionary Biology and Ecology using bats.

The book is now available from the UCD website (http://www.ucd.ie/scienceforschools/), free of charge, to all secondary schools. It’s worth checking it out – these materials contain plenty of interesting student activities, allowing to bring the excitement of cutting-edge science into the secondary school classroom. We are also going to lauch a science video competition for Irish secondary school students soon (http://www.ucd.ie/scienceforschools/video_competition.html), so stay tuned!

Clare and Olivia completed their training in bat lab…

… but that’s not the end of Science for Schools programme! See:

http://batlab.ucd.ie/xml/Science_for_Schools/index.html

to learn more about UCD bat lab and find out how you can bring bat reasearch to the school classroom!

BAT LAB Day 19 – 2 days to go !

Fun Fact: The Scientific name for the bat is Chiroptera

Can’t believe that there are only 2 days left. The time has just flown by. We have spent the last week putting our ideas for our Transition Year resource together and we have today and tomorrow to finalise the draft. We have had so many ideas that the challenge has been to chose what to keep and what to leave out. We are hoping that our book will accurately reflect our time in the BAT LAB, highlighting the wonderful work that is happening here, whilst being a practical handbook that will be useful in the classroom. Today I will be working on the ‘Ecology and Ecosystems’ part of the book so I’ll sign off now and begin. Until tomorrow….

Bat Lab Day 12 – Turbines, Traps and Transects!

Fun Fact: The Royal Botanic Gardens in Sydney Australia is home to a large number of Flying Foxes.

Today we had a look at some more bat detectors and the software that can then be used to create and analyse sonograms.

• The Frequency Division Detector:  which acts by dividing the incoming frequency by a factor of 10 resulting in a sound that can be heard by the human ear. Sound is captured continuously and in real-time.
• Time Expansion Detectors: capture a brief second of a call and then slows that down by a factor of 10, allowing the entire structure of the call to be analysed.
• Full Spectrum Real Time Sampling Detectors: combines the detailed call analysis and real-time sampling.

Check out the website below for additional information.

http://www.bats.org.uk/pages/bat_detectors.html#TE

It is amazing what you can learn from a sonogram,e.g. the shape of the call of the Common Pipistrelle is a hockey stick shape as is the Leisler’s (albeit it a slightly longer shape).  These calls are in contrast to those of the Myotis species where the calls appear as a straight line.

In Ireland, bats mainly live in man-made structures and deciduous woodlands(ideally near water). Loss of habitat is a huge and ongoing issue and loss of roosts may be as a result of timber treatment, tree felling, disturbance by other animals such as cats and water pollution to name but a few.

Research is currently underway to study the effect of windfarms on bats in Ireland.

http://batlab.ucd.ie/research

With regards to the wind turbines, it is thought that bats can be injured or may die in two ways: Firstly, by direct collision with the blades of the turbine. Secondly, there is a pocket of low pressure just behind the blade. If the bat gets caught in this pocket it is thought that the change in pressure will result in haemorraging of the lungs, similiar to what divers can experience with decompression sickness (the bends). The current research is looking at seasonal patterns in bat presence, bat activity during high risk periods, evidence of bat movements and bat activity during winter (it is thought that Irish bats don’t migrate). The research is focusing on striving to find answers to the following: when are the bats on/not on the wind farms and why. A large amount of transects have been studied to date and the data will be used for Species Distribution Modelling and to identify areas that are unfavourable for bats and suitable for windfarms.

We also looked at different types of nets/traps that are used to capture bats with minimal distress. Firstly, we looked at a Mist Net which is a mesh of nylon that is suspended between 2 poles. The net is quite delicate and care needs to be taken when unfolding or folding it away as a mass of tangles may ensue (think Christmas Tree lights)

The second type of net that we looked at was the Harp Trap consisting of layers of ‘harp strings’  suspended from poles.

A fanatastic 2 days. Thanks Una.

 

 

 

 

BAT LAB Day 11 – Bat Talks – Night Walks.

FUN FACT: There are 9 species of bat resident in Ireland and they are all insectivorous.

Today we got to spend time with Una Nealon who gave us an excellent talk on all things ‘Batish’. Bats are among the most diverse and successful animals in the world. They are hugely important to agriculture as they prey on insects. In an Article  published in Science by Boyles et al;  entitled,  Economic Importance of Bats in Agriculture, it is estimated that agricultural losses upwards of $3.7 billion a year could be possible if bats were lost in North America.

http://www.sciencemag.org/content/332/6025/41.short

Bats are often thought to have poor eyesight but this is not the case. However they do hunt in the dark using sound. They build up an image of their surroundings using high frequency calls. It’s all about Echolocation, Echolocation, Echolocation.

Echolocation is individual to each species and although bats make social sounds that can be picked up by the human ear, their echolocation is completely inaudible to human hearing. Therefore, it is necessary to use bat detectors to pick up their calls. There are several types of detector available but we are going on a bat walk tonight (can’t wait!!)  and the detector we will be using is a Heterodyne Tuneable Detector.

The detectors have an ultrasonic microscope and by adjusting the tuning frequency,  different calls become audible. Bats will sweep through frequencies so if a detector is set at 45kHz, it can pick up many species.

I mentioned a night walk. As we meet in the car park I am so excited. Armed with a flash light and a detector, I am like a kid at Christmas tuning into different frequencies and trying to pick up calls. With the detector set at 25kHz, I hear a Leisler’s  Bat. This is the biggest Irish bat and is usually seen just after sunset. Our bat is putting on a show, flying in large circles over the park. I have read that these bats can often be mistaken for swifts. Once my eyes begin to adjust to the darkening skies, I can understand why.  I am suddenly aware of lots of movement. Is it a bird? Is is a bat? No, it’s a large moth!!  Thankfully, listening for the echolocation calls keeps me on track.

As the night progresses, adjusting the detector to a frequency of 45kHz and then 55kHz allows us to pick up the calls of the Common Pipistrelle and the Soprano Pipistrelle respectively. These are Ireland’s two smallest bat species. There is a hive of activity over the river and it is fascinating to watch their fast and convoluted flight patterns. Amazingly, each  little bat is capable of consuming thousands of insects in one night.

The Daubenton’s bat which I have mentioned in a previous blog remains elusive tonight but all in all we have had a fantastic bat walk. Thanks a million Una.

The following websites are packed full of information and it is also possible to hear recorded bat calls.

http://www.bats.org.uk/

http://www.batconservationireland.org/

Bat Morphology- We also spent some time today learning about bat morphology and using keys to identify our mystery bats. By answering questions such as:

• Are the ears separate or are they joined over the head?
• How big is the bat?  This is answered by measuring head&body in mm and the forearm (elbow to wrist)  in mm.
• Is there a post calcarial lobe present?
• What shape is the tragus ?

it is possible to identify bats through a process of elimination.

Ears separate

Ears Joined

Vernier Calipers for taking measurements.

Another great day. Thanks everyone.

 

 

 

BAT LAB – Day 10 already! Where did that time go?

 Fun Fact: One of the bat species found in Ireland is the Daubenton’s Bat. It is sometimes called the ”water bat’ as it skims the water in search of prey. It also has the ability to swim if required.

Day 10 in the Bat Lab and today Olivia and I have a planning day. Our project is to build a resource for Transition Year students and teachers. As we sit and chat we are both bursting with enthusiasm and ideas. We have learned so much in our time here so far and really want to put a programme in place that will inspire the students to love learning.  As we continue to chat,  we realise that we have so many ideas, the problem will be cutting them down to a realistic 6 – week  TY module. We also discuss that for the most part, the students entering TY, will not have had much exposure to the field of genetics. So, with a starting point and a consolidated end point in mind we divide up the workload and begin researching. We are endeavouring to incorporate several areas of Biology into the programme, namely, Ecology, Evolution, Genetics, Cell Biology and Botany.

Next week we are out on a field trip to see if we can find some bats. Will keep you posted. until then …

 

 

 

BAT LAB DAY 9

FUN FACT: Tequila is distilled from Agave juices and bats pollinate the Agave plants.

Today was spent honing our new found computer skills to ensure that we were able to use all of the software programmes to build Phylogenetic Trees. Today I chose to look at von Willebrand’s factor in a variety of species. Using the 5 step process that Graham had shown us, I endeavoured to draw my tree.

Step 1: Pinpoint sequences that are homologs to the sequence that you wish to study.

Step 2: Choose which sequences to incorporate into the tree.

Step 3: Save the sequences into one folder.

Step 4: Carry out Sequence Alignment.

Step 5: Draw a Phylogenetic Tree using the aligned sequences.

Results from Alignment using Clustal X2

 

Neighbour Joining Tree

Maximum parsimony Tree

Maximum Likelihood Tree

The real skill of course, apart from choosing the homologs that will appear in the tree is the meaningful interpretation of the trees themselves. Methinks that this might take longer than a day or two to master 🙂

Graham also introduced us to a programme called UCSF Chimera  which allows molecular structures to be visualized.

cytochrome b

 Yet another great day. Thanks Graham.

Tomorrow, Olivia and I are planning to put pen to paper to start our TY resource book. We have a multitude of ideas and can’t wait to get started. Until then……

 

BAT LAB – Days 7 and 8 – Phylogenetics

FUN FACT – The smallest bat is the Kitti’s Hog-Nosed bat which is also called the Bumblebee bat.

Over the past 2 days, Graham (with endless patience, thanks Graham)  has introduced us to the exciting world of Phylogenetics.  This is the area of Science where molecular sequencing data matrices and morphological data matrices are used to study the evolutionary relatedness between different groups of organisms. The goal  was to build a Phylogenetic Tree!!

Challenge accepted !!

Thankfully these are a variety of computer programmes that can carry out the steps required to achieve the end result amazingly quickly.  After BLASTING  on Day 6, the next task was Sequence Alignment where sequences of DNA are arranged in a way that allows for similar regions to be identified. These similar regions may be due to the evolutionary relatedness between the sequences. We chose to look at cytochrome b in five different species of bat. To carry out the alignment, we used a programme called Clustal X2.

Results from Alignment using Clustal X2

Once this alignment was complete, it was time to use another programme called Mega to build our Phylogenetic Tree. The tree shows the inferred evolutionary relationships between species. Challenge completed.

In reality however, it is more complex and much thought is required when selecting the sequences that should be included and much knowledge is required to meaningfully interpret the results once the tree has been drawn.

In the afternoon, we had a chance to sit with Prof. Teeling to talk about bats as a novel model for sensory driven speciation.

Olivia and I also had a good chat about our TY project plan.

Yet another great day in the BAT LAB. Thanks everyone.

BAT LAB Day 6 – Introduction to Bioinformatics!

Fun Fact: Bats can keep warm by wrapping their wings around them. This traps a layer of air around their bodies providing insulation.

I’ve said it already but I loved being in the lab last week. When we finished on Friday we had purified DNA, run PCR and visualised our samples post electrophoresis.

Loving the Lab Work 🙂

So what comes next? Well, if your samples are of a good quality and the concentration of DNA in the samples is sufficient, the samples can undergo DNA sequencing, a technique by which the exact order of nucleotides within a DNA molecule can be determined. The process has come a long way since the initial manual  2-D chromatography methods were developed and today, automated procedures are used which have the advantage of speeding up turnaround times.

The sequencing result may look something like this: GAATAAATGTTGATACAGAATTGGGTCTCCTCCTCCTGCTGGGTCAAAGAATGAGGTATTTAAATTTCGA
TCAGTTAATAATATAGTAATTGCCCCGGCTAAAACTGGTAAAGATAAAAGTAATAATAAAGCTGTAATTA
CAACTGATCATACAAATAAAGGTATTCGATCTAAAGTAATTCCTGATGATCGTATATTAATTACAGTTGT
AATAAAATTTACAGCTCCTAAAATTGAAGAAATTCCGGCTAAATGTAAAGAGAAAATTGCTAAGTCAACA
GAAGCTCCACCATGTGCAATTCCTGATGATAGGGGAGGATAAACAGTTCACCCTGTTCCGGCCCCATTTT
CCACTATACTACTGACTAGAAGAAGGGATAGAGCTGGGGGAAGAAGTCAAAAACTTATATTATTTATTCG
AGGGAAGGCCATATCTGGGGCTCCCAATATTAAAGGAACTAATCAATTTCCAAATCCTCCAATTATAATA
GGTATAACTATAAAAAAAATTATAATAAAAGCATGAGCTGTAACATCT

……… to which I may respond AGHHHHHHHHHHHHHH, feeling like Neo before he learned how to read the Matrix!!

Thankfully, we are introduced to Graham who is going to introduce us to the world of Bioinformatics where software tools are used to analyse biological data.

Graham introduces us to software known as BLAST (Basic Local Alignment Search Tool). By using this software, the unknown or query sequence can be compared and contrasted against a database of known sequences. Amazingly, it does this in a matter of seconds.

Results from BLAST search

Results from BLAST search

The above results are from the analysis of bat faeces. By examining these results, it can be deduced that this particular bat ate mainly insects.

So why are we doing this?

We are looking for homologs. By studying homologs, it is possible to follow the evolutionary history of genes and to study other areas such as population changes.

The next step after BLAST is alignment. this brings us into the exciting world of Phylogenetics – more on that tomorrow.

 

 

 

 

 

 

Bat Lab Day 5

Fun Fact – Bats always exit stage cave left!  (The jury is still out on this one but more about echolocation in the coming weeks.

Day 5 in the Bat Lab and suffice to say, the week has flown. I am absolutely loving being back in the lab after being away from bench work for a few years.

Our task for this morning was to carry out electrophoresis on our samples from yesterday. Our results were not great this time and this turned out to be a fantastic learning opportunity. We discovered that our gel may not have been set completely before loading our samples, that our buffer needed changing and that human error  is always possible. Thankfully we had enough sample to repeat our experiment and paying attention to the potential errors outlined above, we had great success on the second run.

 

So what does all this barcoding tell us?

These  techniques can be used to identify and distinguish between different species. Choosing the right primer to amplify the correct section of DNA is paramount. If the primers are constructed around species – specific single nucleotide polymorphisms in the mitochondrial gene then species-specific bands are visible on the gel post electrophoresis thus allowing species identification and differentiation to be studied.

Spot the difference?

At the close of week 1, I would like to express my sincere thanks to Dr. Lao for her endless patience and fantastic teaching this week. Looking forward to next week already 🙂